Glycyrrhizin potentially suppresses the inflammatory response in preeclampsia rat model

Fang Liu, Xiuzhi Yang, Junxiang Xing, Ke Han, Yuan Sun*
Department of Obstetrics, ZIBO Central Hospital, No. 54 Gongqingtuan West Road,

Abstract

Objective: The expression of high-mobility group box 1 (HMGB1) in trophoblasts is elevated, which contributes to the development of preeclampsia. Thus, this study aimed to investigate the effect of glycyrrhizin, a natural HMGB1 inhibitor, on the development of preeclampsia.
Methods: Preeclampsia was induced in pregnant Lewis rats through oral administration of L-NAME (50 mg/kg/day) on gestational day (GD) 13-19. Glycyrrhizin (10, 30, or 60 mg/kg/day) was given by oral gavage on GD 10-19. Systolic blood pressure (SBP), diastolic blood pressure (DBP), 24-hour proteinuria, live pup birth ratio, pup weight, pup body length, and placental weight were measured. Also, the expression levels of inflammatory factors (TNF-α, iNOS, IL-1, and IL-6), HMGB1, and TLR4 in the placenta or in the serum were analyzed by enzyme-linked immunosorbent assay, RT-PCR, and Western blot analysis.
Results: Glycyrrhizin significantly reduced the SBP, DBP, and 24-hour proteinuria on GD 16 and 20 in a dose-dependent manner and ameliorated the pregnancy outcomes in preeclampsia rats. The elevated inflammatory molecule levels were markedly decreased by glycyrrhizin not only in the serum but also in the placenta. Moreover, the upregulated HMGB1 and TLR4 expression levels were diminished by glycyrrhizin administration.
Conclusion: This study shows that glycyrrhizin could alleviate preeclampsia and the preeclampsia-associated inflammatory reaction, and this effect could be attributed to HMGB1 inhibition.
Keywords: Glycyrrhizin; L-NAME; HMGB1; TLR4; Preeclampsia

Introduction

Pregnancy-induced hypertension (PIH) is characterized by high blood pressure (140/90) and by the absence of protein in the urine; PIH affects around 6%-8% of women during their pregnancy and it can lead to preeclampsia, a serious condition that can even be fatal to a mother and her child [1-3].
Short-term and long-term therapies, such as labetalol, hydralazine, sustained-release nifedipine, and methyldopa, can treat PIH and/or can alleviate PIH-related symptoms. However, drug therapy is somewhat controversial as it may put both a mother and her child at risk given that most drugs can cross the placenta and enter into the fetal circulation [4,5].
High-mobility group box 1 (HMGB1) was originally described as an essential chromatin protein that interact with histones, nucleosomes, and transcription factors to loosen packed DNA, remodel the chromatin organization, and regulate transcription. Most recently, HMGB1 has been found to act as a pro-inflammatory danger signal that can induce sterile inflammation when released from necrotic cells or from cells under stress [6-9]. HMGB1 can be detected in the nucleus and/or in the cytoplasm of trophoblasts, and it can translocate from the nucleus to the cytoplasm or it can be released into the extracellular environment and act as a danger signal. The circulating level of HMGB1 is elevated in many inflammation-related diseases, including PIH [10]. Upregulated HMGB1 can also be observed in syncytiotrophoblast cells and is correlated with the severity of preeclampsia [11,9].
Glycyrrhizin, a component of the Chinese medicine licorice root, has been utilized to treat asthma, dry cough, and other pectoral diseases. Glycyrrhizin demonstrates the ability to inhibit HMGB1 expression and thus alleviates inflammation, oxidative stress, and apoptosis [12-14]. Therefore, glycyrrhizin can function as HMGB1 inhibitor. However, glycyrrhizin has not yet been tested in PIH. This study was thus performed to investigate the role of glycyrrhizin in preeclampsia and its relevant effects on inflammatory response.

Methods and materials

Preeclampsia rat model establishment and animal treatment
All animal studies were approved by the Ethics Committee of Zibo Central Hospital. Female and male Lewis rats ( 8-10 weeks old) were mated at a 1:1 ratio. On the second day of mating, the female rats with a vaginal plug were considered pregnant, and the date of plug detection was marked as gestational day (GD) 1.
In humans, PIH generally occurs during the third trimester (after 20 weeks of pregnancy). In simulating such a condition, L-NAME (50 mg/kg/day) was first administered on GD 13 by mixing it with the rats’ drinking water, which was loaded continuously for seven days given that the gestation period of Lewis rats is approximately 21 days. Glycyrrhizin was purchased from Sigma-Aldrich and administered orally (at 10, 30, and 60 mg/kg/day from GD 10 to GD 19) as previously recommended [15]. Twelve pregnant rats were randomly selected to be treated as indicated above. The healthy pregnant rats without being subjected to any treatment and which constitute the control group were utilized to obtain the baseline levels of the investigated clinical and laboratory characteristics. Serum and placental samples were obtained on GD 20.

Quantitative real-time RT-PCR (qRT-PCR)
TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from the placenta. RNA (1 µg) was reverse-transcribed using High-Capacity cDNA Reverse Transcription kits (Applied Biosystems, Foster City, CA). SYBR Green master mix (Roche, Mannheim, Germany) was utilized to assay the relative expression of the genes of interest after being normalized to GAPDH expression using the comparative ΔCT method. The PCR process was performed on an ABI STEPONE Real-Time PCR System (Applied Biosystems) and it consisted of initial denaturation at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The primer sequences are listed in Table 1. Melting curve analyses were performed to verify the specificity of the amplification.

Blood pressure and urinary protein measurement
In measuring the systolic blood pressure (SBP) and diastolic blood pressure (DBP), the rats were preheated to 40 °C for 5 min and their tails were bound to a pressure cuff that was subsequently inflated (increasing the pressure by at least 30 mmHg). Then, the cuff was decompressed slowly and a sphygmomanometer and a Medlab system (MK-1030; Muromachi Kikai Co., Ltd., Tokyo, Japan) were used to measure and record the blood pressure levels. The rats were allowed to habituate to this procedure for seven days before the actual experiments were performed. The SBP or DBP of each rat was measured three times with an interval of 60 s, and the median was obtained for analysis. The rats were assessed on GD 12, 16, and 20. The urine samples for the 24-hour proteinuria test were collected on GD 12, 16, and 20 in standard metabolic cages, and proteinuria in each group was detected with Sigma post-administration Coomassie Brilliant Blue kits.

Western blot analysis
Soluble tissue lysates from the placenta (50 µg) were separated with 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto a PVDF membrane and incubated with the primary antibody of HMGB1 (sc-56698), toll-like receptor 4 (TLR4) (sc-293072), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-365062) (Santa Cruz Biotechnology Inc., Santa Cruz, CA; 1:1000 dilution, 4 °C overnight). The signal was developed with a peroxidase-conjugated secondary antibody (Sigma-Aldrich, St. Louis, MO; 1:1000 dilution, 1 h at room temperature) and with an ECL system (GE Healthcare Life Sciences, Chalfont, UK). The relative intensities of the genes of interest were calculated by correcting for GAPDH from the same sample using the Multi-Analyst software (Bio-Rad Laboratories).

Enzyme-linked immunosorbent assay (ELISA)
Tail vein blood samples were collected and the serum HMGB1 (E-EL-R0505c, Elabscience Biotechnology Co.,Ltd, China), TNF-α (ab236712, Abcam, USA), iNOS (ab253219, Abcam, USA), IL-1β (ab255730, Abcam, USA), and IL-6 (ab234570,
Abcam, USA) levels were measured with corresponding ELISA kits according to the manufacturer’s instructions. A microplate reader (SpectraMax M5, Molecular Devices) was utilized to measure the standards and samples at 450 nm wavelength.

Statistical analysis
SPSS 17.0 was used for statistical analysis. Data are presented as mean ± standard deviation (SD). Differences between groups were analyzed with one-way ANOVA with a Tukey’s post hoc test. P < 0.05 was considered statistically significant.

Results

Glycyrrhizin relieves blood pressure and proteinuria in preeclampsia rats
From GD 13 to 19, the pregnant female rats were provided with L-NAME-treated drinking water to induce preeclampsia, which is indicated by an elevated SBP (Figure 1A) and 24-hour proteinuria (Figure 1B). On GD 16 and 20, the glycyrrhizin-treated rats showed significantly lower SBP and proteinuria compared with the PIH group. It is worth noting that the highest dose of glycyrrhizin (60 mg/kg) decreased the SBP and proteinuria most effectively compared with the lower doses (10 and 30 mg/kg) (Figure 1A and Figure 1B). Moreover, the highest dose of glycyrrhizin attenuated the increase in DBP (Figure S1A) and mean arterial pressure (Figure S1B) in preeclampsia rats. The safety of glycyrrizin use in normal pregnant rats was evaluated based on SBP (Figure S2A), 24-hour proteinuria (Figure S2B), live pup birth ratio (Figure S2C), pup weight (Figure S2D), pup body length (Figure S2E), and placental weight (Figure S2F). The results indicated that a high dose of glycyrrhizin could relieve blood pressure and proteinuria in preeclampsia rats.

Glycyrrhizin improves the reproductive outcome of preeclampsia rats
The litter size at birth in different groups was measured, and the results indicated that the high-dose glycyrrhizin treatment did not improve the litter size (Figure S3); however, it restored the decreased live pup birth ratio in the preeclampsia group (p < 0.05) in a dose-dependent manner (Figure 2A). Expectedly, glycyrrhizin increased the pup weight (Figure 2B), pup body length (Figure 2C), and placental weight (Figure 2D) in a dose-dependent manner when compared with preeclampsia rats. These results showed that a high-dose glycyrrhizin treatment could improve the reproductive outcome of preeclampsia rats.

Glycyrrhizin attenuates inflammatory stress in preeclampsia rats
The levels of proinflammatory cytokines, such as TNF-α (Figure 3A), IL-1 (Figure 3C), and IL-6 (Figure 3D), were significantly increased in the preeclampsia rats compared with those in healthy pregnant rats. The same trend was observed in iNOS (Figure 3B), the expression of which can be induced by inflammatory stimuli and is considered as the down-stream reaction of pathological immune responses. Moreover, it is worth noting that the high-dose glycyrrhizin treatment markedly decreased the serum secretion of TNF-α (Figure 3A), iNOS (Figure 3B), IL-1 (Figure 3C), and IL-6 (Figure 3D) when compared with the preeclampsia rats.
To identify the source of inflammatory factors, the relative expression levels of TNF-α (Figure 4A), iNOS (Figure 4B), IL-1 (Figure 4C), and IL-6 (Figure 4D) in the placenta were detected with RT-PCR, and the results indicated that glycyrrhizin treatment could downregulate the expression of such molecules. The results above suggested that glycyrrhizin could alleviate the inflammation associated with preeclampsia.

Glycyrrhizin ameliorates the upregulated HMGB1 in preeclampsia rats
It has been demonstrated that glycyrrhizin can directly inhibit the function of HMGB1. HMGB1 is a vital ligand of TLR4, which is closely associated with downstream inflammatory cascades. Expectedly, glycyrrhizin administration downregulated the mRNA expression of both HMGB1 (Figure 5A) and TLR4 (Figure 5B) in a dose-dependent manner. The protein levels of HMGB1 (Figure 5C) and TLR4 (Figure 5D) were also downregulated after the glycyrrhizin administration in the placenta. Furthermore, the upregulated HMGB1 expression in the preeclampsia rats was ameliorated by glycyrrhizin (Figure S4). All of these results indicated that the promotion of reproductive outcome and downregulation of inflammatory reaction could be attributed to the inhibition of HMGB1.

Discussion

Although the pathological mechanism of preeclampsia is not entirely understood, the functional dysregulation of the placenta is generally involved in the progress of preeclampsia. The hypoxic micromilieu of fetoplacental site, the aberrantly secreted proinflammatory substances into the maternal circulation, and the shear stress exerted by the uteroplacental blood flow can synergistically promote the progression of preeclampsia from PIH [16]. An inadequate blood supply for the developing uteroplacental unit due to the vascular reaction to hypertension will render the placenta hypoxic and ischemic [17-19]. In such a compensation or decompensation condition, the uteroplacental unit may release pathogenic factors that may promote the development and progression of preeclampsia. iNOS catalyzes the generation of nitric oxide and L-citrulline from L-arginine and molecular oxygen, which can function as vasodilators.
In this study, L-NAME, an analog of L-arginine, is utilized to induce preeclampsia. L-NAME can bind and compete at the active site of NOS, can reduce NO synthesis, and can induce preeclampsia characterized by such symptoms as generalized vasoconstriction, inadequate blood delivery, and impaired uteroplacental perfusion [20-22]. Glycyrrhizin is administrated by oral gavage from GD 10 to 19, and the results show that glycyrrhizin administration exerts no effect on blood pressure and proteinuria in pregnant rats on GD 12, indicating that glycyrrhizin is safe to use during pregnancy. Moreover, glycyrrhizin

improves the reproductive outcome and alleviates the increased blood pressure and proteinuria in preeclampsia rats. Further investigation demonstrates that glycyrrhizin administration not only regulates the inflammatory factors (TNF-α, iNOS, IL-1, and IL-6) in the serum, but also inhibites the expression levels of HMGB1 and TLR4 in the placenta of PIH rats. These findings are consistent with the previous observation that glycyrrhizin is a direct natural inhibitor of HMGB1 and that it can block the release of HMGB1 into the extra-cellular environment [15].
In addition to its function as a transcription factor and as a DNA-binding nuclear protein, the HMGB1 released by necrotic cells or by cells under stress can work as a proinflammatory danger signal that activate dendritic cells by triggering TLR4, by inducing NFκB activation, and by producing proinflammatory cytokines, such as TNF-α, IL-1, and IL-6 [23,24]. The altered profile of dendritic cells and regulatory T cells in the peripheral blood of pre-eclamptic women can be attributed to a dysregulated immune tolerance [25,26]. Another study demonstrates that elevated serum IL-6 and TNF-α levels are associated with preeclampsia, and IL-6 and TNF-α might be the potential predictors of prognosis of preeclampsia [27]. It must be pointed out that, in addition to TLR4, the released HMGB1 can also interact with TLR2 and with advanced glycation end products (RAGE), which may also take part in the response to tissue damage.
The short-term effect (2 days post-administration) of glycyrrhizin on pregnant rats is also investigated, and no blood pressure and proteinuria alterations are detected. However, a limitation of this study should be taken into account, that is, this investigation is designed to demonstrate only the preventive effects of glycyrrizin on L-NAME-induced preeclampsia. The use effect of glycyrrizin as treatment against L-NAME-induced preeclampsia should be investigated in the future. Overall, although the precise mechanism of glycyrrhizin still needs to be explored, glycyrrhizin can be considered as an option to be administered in advance to alleviate preeclampsia.

Conclusion

Further investigations are needed to elucidate the molecular mechanisms involved in the glycyrrhizin-mediated suppression of preeclampsia. As a natural inhibitor of HMGB1, glycyrrhizin enhances the reproductive outcome, reduces blood pressure and proteinuria, and regulates the expression levels of HMGB1 and TLR4. Thus, it can potentially be used to prevent or treat preeclampsia.

References

1. Apicella C, Ruano CSM, Mehats C (2019) The Role of Epigenetics in Placental Development and the Etiology of Preeclampsia. 20. doi:10.3390/ijms20112837
2. Kazmi N, Sharp GC, Reese SE, Vehmeijer FO, Lahti J, Page CM, Zhang W, Rifas-Shiman SL, Rezwan FI, Simpkin AJ, Burrows K, Richardson TG, Santos Ferreira DL, Fraser A, Harmon QE, Zhao S, Jaddoe VWV, Czamara D, Binder EB, Magnus MC, Haberg SE, Nystad W, Nohr EA, Starling AP, Kechris KJ, Yang IV, DeMeo DL, Litonjua AA, Baccarelli A, Oken E, Holloway JW, Karmaus W, Arshad SH, Dabelea D, Sorensen TIA, Laivuori H, Raikkonen K, Felix JF, London SJ, Hivert MF, Gaunt TR, Lawlor DA, Relton CL (2019) Hypertensive Disorders of Pregnancy and DNA Methylation in Newborns. Hypertension 74:375-383. doi:10.1161/hypertensionaha.119.12634
3. Kintiraki E, Papakatsika S, Kotronis G, Goulis DG, Kotsis V (2015) Pregnancy-Induced hypertension. Hormones (Athens) 14:211-223. doi:10.14310/horm.2002.1582
4. Alavifard S, Chase R, Janoudi G, Chaumont A, Lanes A, Walker M, Gaudet L (2019) First-line antihypertensive treatment for severe hypertension in pregnancy: A systematic review and network meta-analysis. Pregnancy Hypertens 18:179-187. doi:10.1016/j.preghy.2019.09.019
5. Sridharan K, Sequeira RP (2018) Drugs for treating severe hypertension in pregnancy: a network meta-analysis and trial sequential analysis of randomized clinical trials. Br J Clin Pharmacol 84:1906-1916. doi:10.1111/bcp.13649
6. Zhu Y, Deng J, Nan ML, Zhang J, Okekunle A, Li JY, Yu XQ, Wang PH (2019) The Interplay Between Pattern Recognition Receptors and Autophagy in Inflammation. Adv Exp Med Biol 1209:79-108. doi:10.1007/978-981-15-0606-2_6
7. Cheng KJ, Alshawsh MA, Mejia Mohamed EH, Thavagnanam S, Sinniah A, Ibrahim ZA (2019) HMGB1: an overview of its versatile roles in the pathogenesis of colorectal cancer. doi:10.1007/s13402-019-00477-5
8. Fu L, Nishibori M (2019) The Role of High Mobility Group Box-1 in Epileptogenesis. Acta Med Okayama 73:383-386. doi:10.18926/amo/57367
9. Shao J, Zhao M, Tong M, Wei J, Wise MR, Stone P, Chamley L, Chen Q (2016) Increased levels of HMGB1 in trophoblastic debris may contribute to preeclampsia. Reproduction 152:775-784. doi:10.1530/rep-16-0083
10. Magna M, Pisetsky DS (2014) The role of HMGB1 in the pathogenesis of inflammatory and autoimmune diseases. Molecular medicine (Cambridge, Mass) 20:138-146. doi:10.2119/molmed.2013.00164
11. Chen Q, Yin YX, Wei J, Tong M, Shen F, Zhao M, Chamley L (2016) Increased expression of high mobility group box 1 (HMGB1) in the cytoplasm of placental syncytiotrophoblast from preeclamptic placentae. Cytokine 85:30-36.
12. Chen H, Guan B, Wang B, Pu H, Bai X, Chen X, Liu J, Li C, Qiu J, Yang D, Liu K, Wang Q, Qi S, Shen J (2019) Glycyrrhizin Prevents Hemorrhagic Transformation and Improves Neurological Outcome in Ischemic Stroke with Delayed Thrombolysis Through Targeting Peroxynitrite-Mediated HMGB1 Signaling. doi:10.1007/s12975-019-00772-1
13. Zheng L, Zhu Q, Xu C, Li M, Li H, Yi PQ, Xu FF, Cao L, Chen JY (2020) Glycyrrhizin mitigates radiation-induced acute lung injury by inhibiting the HMGB1/TLR4 signalling pathway. J Cell Mol Med 24:214-226. doi:10.1111/jcmm.14703
14. Sun X, Zeng H, Wang Q, Yu Q, Wu J, Feng Y, Deng P, Zhang H (2018) Glycyrrhizin ameliorates inflammatory pain by inhibiting microglial activation-mediated inflammatory response via blockage of the HMGB1-TLR4-NF-kB pathway. Exp Cell Res 369:112-119. doi:10.1016/j.yexcr.2018.05.012
15. Kong ZH, Chen X, Hua HP, Liang L, Liu LJ (2017) The Oral Pretreatment of Glycyrrhizin Prevents Surgery-Induced Cognitive Impairment in Aged Mice by Reducing Neuroinflammation and Alzheimer’s-Related Pathology via HMGB1 Inhibition. 63:385-395. doi:10.1007/s12031-017-0989-7
16. Furuya M, Ishida J, Aoki I, Fukamizu A (2008) Pathophysiology of placentation abnormalities in pregnancy-induced hypertension. Vasc Health Risk Manag 4:1301-1313. doi:10.2147/vhrm.s4009
17. Ishimitsu T (2017) Starting the new review series: Pregnancy-Induced Hypertension. Hypertens Res 40:3-4. doi:10.1038/hr.2016.105
18. Reddy S, Jim B (2019) Hypertension and Pregnancy: Management and Future Risks. Adv Chronic Kidney Dis 26:137-145. doi:10.1053/j.ackd.2019.03.017
19. Leavitt K, Obican S, Yankowitz J (2019) Treatment and Prevention of Hypertensive Disorders During Pregnancy. Clin Perinatol 46:173-185. doi:10.1016/j.clp.2019.02.002
20. Wang Y, Huang M, Yang X, Yang Z, Li L, Mei J (2018) Supplementing punicalagin reduces oxidative stress markers and restores angiogenic balance in a rat model of pregnancy-induced hypertension. Korean J Physiol Pharmacol 22:409-417. doi:10.4196/kjpp.2018.22.4.409
21. Kopincova J, Puzserova A, Bernatova I (2012) L-NAME in the cardiovascular system – nitric oxide synthase activator? Pharmacol Rep 64:511-520. doi:10.1016/s1734-1140(12)70846-0
22. Pechanova O, Dobesova Z, Cejka J, Kunes J, Zicha J (2004) Vasoactive systems in L-NAME hypertension: the role of inducible nitric oxide synthase. J Hypertens 22:167-173. doi:10.1097/00004872-200401000-00026
23. Lotze MT, Tracey KJ (2005) High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat Rev Immunol 5:331-342. doi:10.1038/nri1594
24. Huang M, Guo M, Wang K, Wu K, Li Y, Tian T, Wang Y, Yan W, Zhou Z, Yang H (2019) HMGB1 Mediates Paraquat-Induced Neuroinflammatory NSC 167409 Responses via Activating RAGE Signaling Pathway. Neurotox Res. doi:10.1007/s12640-019-00148-1
25. Wang J, Tao YM, Cheng XY, Zhu TF, Chen ZF, Yao H, Su LX (2015) Vascular endothelial growth factor affects dendritic cell activity in hypertensive disorders of pregnancy. Mol Med Rep 12:3781-3786. doi:10.3892/mmr.2015.3783
26. Li J, Huang L, Wang S, Zhang Z (2019) The prevalence of regulatory T and dendritic cells is altered in peripheral blood of women with pre-eclampsia. Pregnancy Hypertens 17:233-240. doi:10.1016/j.preghy.2019.07.003
27. Li Y, Wang Y, Ding X, Duan B, Li L, Wang X (2016) Serum Levels of TNF-alpha and IL-6 Are Associated With Pregnancy-Induced Hypertension. Reprod Sci 23:1402-1408. doi:10.1177/1933719116641760

Figure legends

Figure 1. Glycyrrhizin attenuated the systolic blood pressure (SBP) and 24-hour proteinuria in preeclampsia rats. The non-invasive tail–cuff method was utilized to measure the SBP of each individual rats in the indicated group on GD 12, 16, and 20 (A). The 24-hour proteinuria was detected with Coomassie Brilliant Blue (CBB) kits in each group on the corresponding days (B). Data are presented as mean ± SEM. n = 12 in each group. ##p < 0.01 and ###p < 0.001 compared with the control group; *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the preeclampsia group.
Figure 2. Glycyrrhizin ameliorated the pregnancy outcomes in preeclampsia rats. The live pup birth ratio (A), pup weight (B), pup body length (C), and placental weight (D) were compared. Data are presented as mean ± SEM. n = 12 in each group. #p < 0.05 and###p < 0.001 compared with the control group; *p < 0.05 and **p < 0.01 compared with the preeclampsia group.
Figure 3. Glycyrrhizin ameliorated the serum inflammatory in preeclampsia rats. ELISA was used to analyze the serum concentrations of TNF-α (A), iNOS (B), IL-1 (C), and IL-6 (D) on GD 20 in the indicated groups. Data are presented as mean ± SEM. n = 12 in each group. ##p < 0.01 and ###p < 0.001 compared with the control group; *p < 0.05,
Figure 4. Glycyrrhizin ameliorated the placental inflammatory response in preeclampsia rats. qRT-PCR was used to measure the mRNA expression levels of TNF-α (A), iNOS
(B), IL-6 (C), and IL-1β (D) in the placenta of the indicated groups on GD 20. Their relative expression levels were analyzed by the comparative threshold cycle (2-ΔΔct) method and normalized to the control group. Data are presented as mean ± SEM. n = 12 in each group. ##p < 0.01 and ###p < 0.001 compared with the control group; *p < 0.05,
Figure 5. Glycyrrhizin ameliorated the placental HMGB1 upregulation in preeclampsia rats. qRT-PCR was used to measure the mRNA expression levels of HMGB1 (A) and TLR4 (B) in the placenta of the indicated groups on GD 20. Their relative expression levels were analyzed by the comparative threshold cycle (2-ΔΔct) method and normalized to the control group. Western blot analysis was used to assay the protein expression levels of HMGB1 (C) and TLR4 (D) in the placenta of the indicated groups on GD 20. GAPDH was used as loading control, and the relative expression levels were normalized to the control group. Data are presented as mean ± SEM. n = 12 in each group. ###p <0.001 compared with the control group; *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the preeclampsia group.

Table 1. Sequence of primers (rat) used for quantitative real-time PCR.
Gene Forward primer (5’-3’) Reverse Primer (5’-3’)
GAPDH CCATCACTGCCACTCAGAAGA CATGAGGTCCACCACCCTGT
HMGB1 CTGATGCAGCTTATACGAAG TCAGGTAAGGAGCAGAACAT
TNF-α CCCCTTTATCGTCTACTCCTC GCTGGTAGTTTAGCTCCGTTT
IL-1β TCATTGTGGCTGTGGAGAAG CTATGTCCCGACCATTGCTG
iNOS GCATCCCAAGTACGAGTGGT GAAGGCGTAGCTGAACAAGG
IL-6 GGATACCACCCACAACAGAC TTGCCGAGTAGACCTCATAG
TLR4 GGACTCTGCCCTGCCACCATTTA CTTGTGCCCTGTGAGGTCGTTGA
TNF-α AGGCGCTCCCCAAGAAGACA TCCTTGGCAAAACTGCACCT

Highlights

1. Glycyrrhizin relieves blood pressure and proteinuria in preeclampsia rats.
2. Glycyrrhizin increases pup weight, body length and placental weight in preeclampsia rats.
3. Glycyrrhizin diminishes proinflammatory level of in the preeclampsia rat serum.
4. Glycyrrhizin ameliorates the up-regulated HMGB1 and TLR4 levels.